Jun 3, 2018 08:50
6 yrs ago
1 viewer *
English term
Ukraine
20 years in translations, Ph.D. (Chem)
Native in: Russian 
Works in: English to Russian, English to Ukrainian
The alpha chain variable region sequence specific oligonucleotide A1
English to Russian
Science
Biology (-tech,-chem,micro-)
The alpha chain variable region sequence specific oligonucleotide A1 which encodes the restriction site...
Proposed translations
(Russian)
| 4 +3 | специфический олигонуклеотид А1 вариабельной области альфа-цепи |
Natalie
|
| 4 | см. |
Igor Andreev
|
Proposed translations
+3
13 mins
Selected
специфический олигонуклеотид А1 вариабельной области альфа-цепи
специфический олигонуклеотид А1 вариабельной области альфа-цепи, кодирующий... и тд
Note from asker:
| Спасибо! |
4 KudoZ points awarded for this answer.
Comment: "Selected automatically based on peer agreement."
5 hrs
Igor Andreev
Native in Russian
Specializes in field
Native in: Russian 
Works in: English to Russian, Ukrainian to Russian, English to Ukrainian
Related KudoZ points
:
1427
см.
полез в патент в итоге )
в контексте это скорее
олигонуклеотид А1, специфичный/ гомологичный к последовательности вариабельного участка альфа цепи,
который использовали в качестве праймера для ПЦР
The reference gp100 TCR variable alpha and TCR variable beta domains were PCR amplified from total cDNA isolated from a gp100 T cell clone. In the case of the alpha chain, an alpha chain variable region sequence specific oligonucleotide A1 (ggaattccatatgagtcaacaaggagaagaagatcc SEQ ID No:39) which encodes the restriction site Ndel....
https://patents.google.com/patent/EP2448963A1/en
The reference MAGE-A3 TCR variable alpha and TCR variable beta domains were PCR amplified from total cDNA isolated from a MAGE-3 T cell clone (Clone EB81- 103 from Pierre Coulie University of Louvain, Belgium). In the case of the alpha chain, an alpha chain variable region sequence specific oligonucleotide A1
(ggaattccatatgaaacaagaagttactcaaattcc SEQ ID No: 14) which encodes the restriction site Ndel ...
https://encrypted.google.com/patents/EP2598528A1
--------------------------------------------------
Note added at 5 hrs (2018-06-03 14:44:43 GMT)
--------------------------------------------------
а вот собственно и оригинал
The alpha chain variable region sequence specific oligonucleotide A1 which encodes the restriction site NdeI, an introduced methionine for efficient initiation of expression in bacteria, and an alpha chain constant region sequence specific oligonucleotide A2 which encodes the restriction site SalI are used to amplify the alpha chain variable region.
олигонуклеотид А1, специфичный/ гомологичный к последовательности вариабельного участка альфа цепи, содержащего сайт рестрикции...
--------------------------------------------------
Note added at 5 hrs (2018-06-03 14:45:59 GMT)
--------------------------------------------------
прошу прощения: содержащий сайт рестрикции - это относится к олигонкуклеотиду
в контексте это скорее
олигонуклеотид А1, специфичный/ гомологичный к последовательности вариабельного участка альфа цепи,
который использовали в качестве праймера для ПЦР
The reference gp100 TCR variable alpha and TCR variable beta domains were PCR amplified from total cDNA isolated from a gp100 T cell clone. In the case of the alpha chain, an alpha chain variable region sequence specific oligonucleotide A1 (ggaattccatatgagtcaacaaggagaagaagatcc SEQ ID No:39) which encodes the restriction site Ndel....
https://patents.google.com/patent/EP2448963A1/en
The reference MAGE-A3 TCR variable alpha and TCR variable beta domains were PCR amplified from total cDNA isolated from a MAGE-3 T cell clone (Clone EB81- 103 from Pierre Coulie University of Louvain, Belgium). In the case of the alpha chain, an alpha chain variable region sequence specific oligonucleotide A1
(ggaattccatatgaaacaagaagttactcaaattcc SEQ ID No: 14) which encodes the restriction site Ndel ...
https://encrypted.google.com/patents/EP2598528A1
--------------------------------------------------
Note added at 5 hrs (2018-06-03 14:44:43 GMT)
--------------------------------------------------
а вот собственно и оригинал
The alpha chain variable region sequence specific oligonucleotide A1 which encodes the restriction site NdeI, an introduced methionine for efficient initiation of expression in bacteria, and an alpha chain constant region sequence specific oligonucleotide A2 which encodes the restriction site SalI are used to amplify the alpha chain variable region.
олигонуклеотид А1, специфичный/ гомологичный к последовательности вариабельного участка альфа цепи, содержащего сайт рестрикции...
--------------------------------------------------
Note added at 5 hrs (2018-06-03 14:45:59 GMT)
--------------------------------------------------
прошу прощения: содержащий сайт рестрикции - это относится к олигонкуклеотиду
Something went wrong...